Stephen Alfred Elmer

Stephen Elmer

Privacy Level: Private with Public Biography and Family Tree (Yellow)
Mr. Stephen A. Elmer aka Mallen
Born 1950s.
Ancestors ancestors
Brother of [private sister (1940s - unknown)] [half] and [private sister (1950s - unknown)] [half]
Descendants descendants
Father of [private son (1990s - unknown)]
Account confirmed 17 Nov 2016 | Stephen's 429 contributions | 243 thank-yous received
Elmer-1809 created 17 Nov 2016 | Last modified
This page has been accessed 494 times.
Wiki Genealogist January 2017 Club 100 Puritan Great Migration Project Member United Kingdom Project Member December 2016 Club 100 LDS Project Member DNA Tested Pre-1700 Honor Code Signatory Volunteer
[view badges]

== Biography == *First-hand information. Entered by Stephen Elmer at registration. Descendent of Edward Elmer one of the founders of Hartford, CT. 1600s

Timeline

"""1954"""I was Born and raised in Hollywood, California I know this because I am this person

Name

Stephen Alfred (ELMER) Mallen

Story I was raised in Hollywood California, and I served in the Army and was released 1973 I began working for the Studios in Hollywood, Specialized in Rigging and Lighting. I worked many shows in the Theatre, Broadway plays like Cats, Wiz, Singing in the rain, Phantom of the Opera. Many Television Shows Donny and Marie, Academy Awards, Price is right and so many more. I also started learning Kung Fu, the Hung Kuen system, Kuen meaning family style of the martial arts World and also known as Hung-Gar. An Art descendent from the Shaolin temple in the 1700s. The Art is Famous for the Tiger & Crane style Kung Fu system using the moves from these animal's, also known for the Snake, Dragon and Leopard techniques. The art is also known in the States from my teacher Master Bucksam Kong Founder 1963 of the Siu Lum Pai Gung Fu Assoc. In 1979 Opening a school for my Sifu or teacher in SLC, Utah 1979. I also taught at the University of Utah and spread the Art to the public. Moving back to Hollywood in1984 learning and teaching and working until 1991 and moved back to SLC had children Andrew and Ashlee. Now in Arizona retired.. Here is a FB link!

== https://www.facebook.com/groups/hungkuenkungfu/ Stephen

Sources

<reference />

  • My Allele Results

SampleID Marker+ Chr Start End Allele


7854 A12481 ChrY 21186262 21186262 C- 7854 A2284 ChrY 21186403 21186403 A+ 7854 DYS449 ChrY 8217908 8218262 29 7854 DYS458 ChrY 7867839 7867961 16.2 7854 M8866 ChrY 21186263 21186263 C- 7854 YP1144 ChrY 21186284 21186284 C- 7854 Z11851 ChrY 21186263 21186263 C-

A2284 HG19 Position: ChrY:21186403..21186403 Ancestral: G Derived: A Reference: Michael Thompson (2015) ISOGG Haplogroup: R1b (not listed) Comments: .

Reverse Primer: A2284_R GCAGAAAGTGGAGCCAAAAG

An Essay by the Elmer/Elmore Group by Mike Thompson et al July 2017

Ancestors of Edward Elmer... Pending DNA Two common and powerful ideas play out over and over again in family trees for Edward Elmer. The first is that Edward is in some way related to Bishop John Aylmer. The second is that Edward the elder came to the colonies on the ship Lyon with his sons Edward and Richard. Like many others, we have tried to explore the sources of these ideas for several years and struggled to make sense of these connections. Approaching the problem from the perspective of DNA, we have been able to triangulate Y DNA through three of the sons of Edward Elmer-195 and have a good family Y STR pattern and several family level Y SNPs. That leaves us in roughly the same boat, we have a genetic signature for the man, but not much information on ancestors except that closely related Y families like the Lunsfords and Knowltons also claim origins in southeast England. Our relationship to them is older than the common use of surnames by a few hundred years. We currently have no genetic evidence of Elmer (or surname variant) ancestors beyond Edward Elmer. Bishop John Aylmer We are not sure how old this association is, but we’ve been able to find references to it in The Compendium of American Genealogy, First Families of America (1925–1942) Volume 1 by Frederick Adams Virkus on page 642, which lists a tree for Edward as the son of Samuel Aylmer, the High Sheriff of Suffolk who in turn is the son of John Aylmer. This tree is presented without sources. Edward Elmer from Connecticut is often associated with Samuel Aylmer and the holdings in Claydon and Mowdon. From Claydon and Mockbeggars Hall by William P. Hills 1937 we can see on pages 11, 12 and 13 that Samuel’s son Edward Aylmer does not disappear to the new world. He appears before a committee on his estates in 1646 and is buried at Claydon Hall in 1655. (The Suffolk Institute of Archaeology & History; Volume XXIII Part 1 (1937) Claydon and Mockbeggars Hall by Wm. P. Hills) We also found a reference for a possible relationship to Theophilus Aylmer of Hertfordshire (also a son of Bishop John Aylmer) in Genealogical Gleanings in England by Henry Waters published in 1892. On page 75 Henry leaves a note saying, “whether Edward Elmer of Connecticut belonged to this family is yet to be proved.” We can gather that at least since the 1890’s people have wanted to connect Edward to Bishop John Aylmer through some means, but we have no source that actually makes that connection. Edward Elmer from Braintree Since Edward Elmer is among the “Braintree Company” on the Lyon, it would make some sense to tie him to Braintree in Essex as John Corley did in 1984 in his Emigration to New England on the Lyon 1632. Edward is listed there simply as “ELMORE or ELMER (from Braintree, Essex; after Newtowne [Cambridge], he lived in Hartford and Windsor)”. Unfortunately, records for this period in Braintree are lost so we have no definitive source for this assertion other than that there are other Elmer families active in this general area of Essex around that time. Corley’s list is interesting because it only contains Edward Elmer who took an oath as a person of quality so that he could emigrate. No other family member is mentioned. Edward, Edward and Richard from Saint Mary Le Bow Charles Manwaring in A Digest of Early Connecticut Probate Records published 1904, lists Edward Elmer and Richard Elmer as landowners on page 83. That is the first reference we can find for a Richard Elmer in Connecticut. Charles Banks, when putting together the epic The Planters of the Commonwealth in 1930, likely used Manwaring as a source for his list of Elmer passengers on the Lyon. Here is a truncated section from Planters that would explain the way these lists are created: “A special feature of this work will be found in what may be called synthetic lists of emigrants… reconstructed from evidences found in every source too numerous to catalogue”. In that same explanation Banks speaks of “some degree of accuracy and probability.” Banks had to work in probabilities because there is no good single source for these people. The Lyon is said to have had 123 passengers represented by only a scattering of heads of households. We suspect that Banks went to London with the Digest of Early Connecticut Probate Records as a source for the Elmer family and with an Edward and Richard Elmer in mind. In Saint Mary Le Bow, Banks would have found a Senior Edward Elmer with a son Richard and a slightly younger son Edward (born around 1610) along with several other Elmer family members who were born there. You can find them too, at familysearch.org easily indexed and at your fingertips, which was not the case for Banks. Because of the proliferation of information online, we have records today that Banks may not have had and information he may never have seen. If you search for Elmore in Saint Mary Le Bow parish records, you will see that the elder Edward had two young sons named Edward, neither of which survived childhood. Richard would appear to be his only surviving son. Searching further you may end up at British History online and see that the elder Edward Elmer died in 1620 and left his lease to his brother John Elmer. That means there were no available Edward Elmers to make the journey. From pages 220-226 St Mary Le Bow from British History Online: “In 1620 Edward Elmer, citizen and fishmonger, left the lease of the house in which he lived in Bow Lane to his executors, his father-in-law Cornelius Fish and his brother John Elmer. Some time before 1633 3A was occupied by John Ellmer and subsequently by his assigns or undertenants.” Familysearch.org provides some further information as Mary Elmer, child of the elder Edward Elmer dies in Saint Mary Le Bow in 1622, indicating the family maintained a presence there beyond 1620. In his 1995 work The Great Migration Begins, Robert Anderson checks up on Manwaring and leaves this note on Edward and Richard Elmer on page 637: In his list of “Early Land Owners,” Manwaring includes in Hartford before 1653 "Ed: Elmer" and "Richard Elmer." The Hartford land records do not contain this latter name, but the source of Manwaring's error has not been determined [Manwaring 1:83]. Anderson cannot find a record for Richard Elmer. It’s possible that reading through hard to decipher handwritten sources, Manwaring confused Richard Semer with Richard Elmer. There is really no way to know, but we do know that Richard Elmer does not appear anywhere else in Manwaring’s own digest while Edward appears many times. The key seems to be in understanding that Banks was creating a massive work and, as other families have sorted out, he got as close as he could for individual families, even if things didn’t always line up. He was dealing with all the planters of the commonwealth, not just a single family and as one family researcher put it “publishing furiously”. In this case we think Banks may have gone to England with a bad source and found a family that fit that source. From that family he created a synthetic passenger list with an elder Edward Elmer and two sons, Richard and Edward without any idea that all his Edwards had died in London and that Richard never existed in the new world. Edward Elmer Combined Family Tree On page 215 of Passengers on the Lion From England to Boston 1632, published in 1992, Sandra Olney lays out a family tree for Edward that appears to be a composite based on Banks passengers list and a family tree from The Compendium of American Genealogy. She lists Edward, Edward and Richard from Banks listing. Where Banks had Mrs. Unknown Elmore, Olney weaves in some of a genealogy from the Compendium that gives Edward’s wife (his only wife in the Compendium family tree) as Elizabeth. Olney presents Elizabeth as Edward’s first wife the mother of Edward and Richard. She also presents a link from the elder Edward to a Samuel Elmer, although he doesn’t appear to be listed as the high Sheriff of Suffolk as he is in the Compendium. This is another common representation of Edward’s family. It has the elder Edward as the only survivor after the trip from England, with Richard and Edward and a wife Elizabeth dying here possibly, and a fresh start with a new marriage and the children we all know about happening in The New World. We think this was probably Olney’s best attempt at sorting Edward out, given the variety of families assigned to him. Publishing in 1992, she would not have Anderson’s work to know that Richard Elmer did not exist. She definitely did not have an easily indexed parish record showing that the elder Edward and his multiple Edward sons died in London. Edward Alone, Conclusion The simplest story we have evidence for is that Edward Elmer travelled to The New World unattached in his 20’s. We don’t have to worry about him being alone. As a single Puritan, he would be placed with another family. One would doubt he had very much time to himself at all. He married, owned property, had children, went to court and died in the new world. As far as we know, he left no record of his parents or grandparents or even his point of origin. Perhaps these things were not as important to him when starting his new life in the promised land. All of our previous sources for the ancestors of Edward were doing their best to present the big picture of the great migration and worked with the resources they had to make conjectures on these individuals unknown past. If you consider that American icons like the Adams family cannot agree on exactly where their ancestor Henry Adams came from (or even the ship he came on) with John Adams and his son John Quincy Adams disagreeing just a few generations away from the source, then you have to wonder if the Puritans were truly putting the past behind them and specifically left no trail to follow. In any case, we are in good company among the lost. With our focus on a single ancestor, rather than an entire migration, and DNA as a tool we have an opportunity to move beyond the genealogies and lists to identify the living relatives and descendants of Edward Elmer wherever they may be.

2017 Y SNP By Lineage


More Genealogy Tools


Only the Trusted List can access the following:
  • Stephen's formal name
  • full middle name (A.)
  • e-mail address
  • exact birthdate
  • birth location
  • images (7)
  • private siblings' names
  • private children's names (1)
  • spouse's name and marriage information
For access to Stephen Elmer's full information you must be on Stephen's Trusted List. Please login. See the Contact section of the Tree & Tools page.


Sponsored by MyHeritage




Followed Tags
Stephen is a Wiki Genealogy Volunteer following these tags:
AYLMER
Family 1600s-1500s-1400s
ELMER
Who are we? Researching Family from the line of Edward Elmer 1600s One of the Founders of Hartford, CT. May have lines to John Elmer-Aylmer Bishop of England 1500s
ELMORE
Other family names
LDS
LDS Family Research and LDS Pioneers in my Family.
NORWAY
Seim Town in Norway looking for info
PGM
Looking for Edward Elmer and info on the ship LYONS.
PURCELL
May have half sister Cindy in Michigan, her mother was Miss Michigan I heard.
SEIM
Mothers side - Country of Norway and a town called Seim I believe.


DNA Tested
Stephen Elmer's DNA has been tested for genealogical purposes. It may be possible to confirm family relationships by comparing test results with Stephen or other carriers of his ancestors' Y-chromosome or mitochondrial DNA. Y-chromosome DNA test-takers in his direct paternal line on WikiTree:

Have you taken a DNA test for genealogy? If so, login to add it. If not, see our friends at Family Tree DNA.



Collaboration
  • Login to request to the join the Trusted List so that you can edit.
  • Private Messages: Send a private message to Stephen. (Best for comments to Stephen that need to be private.)
  • Public Comments: Login to post. (Best for messages to or about Stephen that can be public. Limit 20 per day.)

On 15 Jul 2017 at 17:37 GMT Stephen Elmer wrote:

Is there LESS evidence of Edward Elmer's ancestors?

An Essay by the Elmer/Elmore Group by Mike Thompson et al July 2017

Ancestors of Edward Elmer... Pending DNA Two common and powerful ideas play out over and over again in family trees for Edward Elmer. The first is that Edward is in some way related to Bishop John Aylmer. The second is that Edward the elder came to the colonies on the ship Lyon with his sons Edward and Richard. Like many others, we have tried to explore the sources of these ideas for several years and struggled to make sense of these connections. Approaching the problem from the perspective of DNA, we have been able to triangulate Y DNA through three of the sons of Edward Elmer-195 and have a good family Y STR pattern and several family level Y SNPs. That leaves us in roughly the same boat, we have a genetic signature for the man, but not much information on ancestors except that closely related Y families like the Lunsfords and Knowltons also claim origins in southeast England. Our relationship to them is older than the common use of surnames by a few hundred years. We currently have no genetic evidence of Elmer (or surname variant) ancestors beyond Edward Elmer. Bishop John Aylmer We are not sure how old this association is, but we’ve been able to find references to it in The Compendium of American Genealogy, First Families of America (1925–1942) Volume 1 by Frederick Adams Virkus on page 642, which lists a tree for Edward as the son of Samuel Aylmer, the High Sheriff of Suffolk who in turn is the son of John Aylmer. This tree is presented without sources. Edward Elmer from Connecticut is often associated with Samuel Aylmer and the holdings in Claydon and Mowdon. From Claydon and Mockbeggars Hall by William P. Hills 1937 we can see on pages 11, 12 and 13 that Samuel’s son Edward Aylmer does not disappear to the new world. He appears before a committee on his estates in 1646 and is buried at Claydon Hall in 1655. (The Suffolk Institute of Archaeology & History; Volume XXIII Part 1 (1937) Claydon and Mockbeggars Hall by Wm. P. Hills) We also found a reference for a possible relationship to Theophilus Aylmer of Hertfordshire (also a son of Bishop John Aylmer) in Genealogical Gleanings in England by Henry Waters published in 1892. On page 75 Henry leaves a note saying, “whether Edward Elmer of Connecticut belonged to this family is yet to be proved.” We can gather that at least since the 1890’s people have wanted to connect Edward to Bishop John Aylmer through some means, but we have no source that actually makes that connection. Edward Elmer from Braintree Since Edward Elmer is among the “Braintree Company” on the Lyon, it would make some sense to tie him to Braintree in Essex as John Corley did in 1984 in his Emigration to New England on the Lyon 1632. Edward is listed there simply as “ELMORE or ELMER (from Braintree, Essex; after Newtowne [Cambridge], he lived in Hartford and Windsor)”. Unfortunately, records for this period in Braintree are lost so we have no definitive source for this assertion other than that there are other Elmer families active in this general area of Essex around that time. Corley’s list is interesting because it only contains Edward Elmer who took an oath as a person of quality so that he could emigrate. No other family member is mentioned. Edward, Edward and Richard from Saint Mary Le Bow Charles Manwaring in A Digest of Early Connecticut Probate Records published 1904, lists Edward Elmer and Richard Elmer as landowners on page 83. That is the first reference we can find for a Richard Elmer in Connecticut. Charles Banks, when putting together the epic The Planters of the Commonwealth in 1930, likely used Manwaring as a source for his list of Elmer passengers on the Lyon. Here is a truncated section from Planters that would explain the way these lists are created: “A special feature of this work will be found in what may be called synthetic lists of emigrants… reconstructed from evidences found in every source too numerous to catalogue”. In that same explanation Banks speaks of “some degree of accuracy and probability.” Banks had to work in probabilities because there is no good single source for these people. The Lyon is said to have had 123 passengers represented by only a scattering of heads of households. We suspect that Banks went to London with the Digest of Early Connecticut Probate Records as a source for the Elmer family and with an Edward and Richard Elmer in mind. In Saint Mary Le Bow, Banks would have found a Senior Edward Elmer with a son Richard and a slightly younger son Edward (born around 1610) along with several other Elmer family members who were born there. You can find them too, at familysearch.org easily indexed and at your fingertips, which was not the case for Banks. Because of the proliferation of information online, we have records today that Banks may not have had and information he may never have seen. If you search for Elmore in Saint Mary Le Bow parish records, you will see that the elder Edward had two young sons named Edward, neither of which survived childhood. Richard would appear to be his only surviving son. Searching further you may end up at British History online and see that the elder Edward Elmer died in 1620 and left his lease to his brother John Elmer. That means there were no available Edward Elmers to make the journey. From pages 220-226 St Mary Le Bow from British History Online: “In 1620 Edward Elmer, citizen and fishmonger, left the lease of the house in which he lived in Bow Lane to his executors, his father-in-law Cornelius Fish and his brother John Elmer. Some time before 1633 3A was occupied by John Ellmer and subsequently by his assigns or undertenants.” Familysearch.org provides some further information as Mary Elmer, child of the elder Edward Elmer dies in Saint Mary Le Bow in 1622, indicating the family maintained a presence there beyond 1620. In his 1995 work The Great Migration Begins, Robert Anderson checks up on Manwaring and leaves this note on Edward and Richard Elmer on page 637: In his list of “Early Land Owners,” Manwaring includes in Hartford before 1653 "Ed: Elmer" and "Richard Elmer." The Hartford land records do not contain this latter name, but the source of Manwaring's error has not been determined [Manwaring 1:83]. Anderson cannot find a record for Richard Elmer. It’s possible that reading through hard to decipher handwritten sources, Manwaring confused Richard Semer with Richard Elmer. There is really no way to know, but we do know that Richard Elmer does not appear anywhere else in Manwaring’s own digest while Edward appears many times. The key seems to be in understanding that Banks was creating a massive work and, as other families have sorted out, he got as close as he could for individual families, even if things didn’t always line up. He was dealing with all the planters of the commonwealth, not just a single family and as one family researcher put it “publishing furiously”. In this case we think Banks may have gone to England with a bad source and found a family that fit that source. From that family he created a synthetic passenger list with an elder Edward Elmer and two sons, Richard and Edward without any idea that all his Edwards had died in London and that Richard never existed in the new world. Edward Elmer Combined Family Tree On page 215 of Passengers on the Lion From England to Boston 1632, published in 1992, Sandra Olney lays out a family tree for Edward that appears to be a composite based on Banks passengers list and a family tree from The Compendium of American Genealogy. She lists Edward, Edward and Richard from Banks listing. Where Banks had Mrs. Unknown Elmore, Olney weaves in some of a genealogy from the Compendium that gives Edward’s wife (his only wife in the Compendium family tree) as Elizabeth. Olney presents Elizabeth as Edward’s first wife the mother of Edward and Richard. She also presents a link from the elder Edward to a Samuel Elmer, although he doesn’t appear to be listed as the high Sheriff of Suffolk as he is in the Compendium. This is another common representation of Edward’s family. It has the elder Edward as the only survivor after the trip from England, with Richard and Edward and a wife Elizabeth dying here possibly, and a fresh start with a new marriage and the children we all know about happening in The New World. We think this was probably Olney’s best attempt at sorting Edward out, given the variety of families assigned to him. Publishing in 1992, she would not have Anderson’s work to know that Richard Elmer did not exist. She definitely did not have an easily indexed parish record showing that the elder Edward and his multiple Edward sons died in London. Edward Alone, Conclusion The simplest story we have evidence for is that Edward Elmer travelled to The New World unattached in his 20’s. We don’t have to worry about him being alone. As a single Puritan, he would be placed with another family. One would doubt he had very much time to himself at all. He married, owned property, had children, went to court and died in the new world. As far as we know, he left no record of his parents or grandparents or even his point of origin. Perhaps these things were not as important to him when starting his new life in the promised land. All of our previous sources for the ancestors of Edward were doing their best to present the big picture of the great migration and worked with the resources they had to make conjectures on these individuals unknown past. If you consider that American icons like the Adams family cannot agree on exactly where their ancestor Henry Adams came from (or even the ship he came on) with John Adams and his son John Quincy Adams disagreeing just a few generations away from the source, then you have to wonder if the Puritans were truly putting the past behind them and specifically left no trail to follow. In any case, we are in good company among the lost. With our focus on a single ancestor, rather than an entire migration, and DNA as a tool we have an opportunity to move beyond the genealogies and lists to identify the living relatives and descendants of Edward Elmer wherever they may be.

2017 Y SNP By Lineage

On 10 Jan 2017 at 21:41 GMT Vic Watt wrote:

Stephen,

U have awarded you PGM Project Member badge. Please be sure to read the Project page. Sorry for the delay, but I have been sick for a while and was doing minimal WikiTree work. Vic

On 9 Jan 2017 at 06:53 GMT Roxanne Baker wrote:

Hello Stephen - I do not know of Seim specifically. Have you done any research for your Norwegian family? Do you know where they are from in Norway?

Roxanne C Basey

On 2 Jan 2017 at 22:07 GMT Robin Lee wrote:

As a reminder, our Honor Code and Pre-1700 Certification are clear about the need for sources. If you need help understanding how to add sources, please take a look at https://www.wikitree.com/wiki/Sources

On 1 Jan 2017 at 09:24 GMT Maria Maxwell wrote:

Hi Stephen and thanks for your message.

I've added the United Kingdom Project badge to your profile. If you click on the badge it will take you to the full list of our wonderful members. Click on United Kingdom Project will take you the first page of the project. Scroll down to Member Interests. I've added your good self.

Thanks again for joining enjoy and good luck with your research Maria

On 24 Dec 2016 at 17:47 GMT Stephen Elmer wrote:

I have new DNA test to add here but I am lost. Help Please.....

On 1 Dec 2016 at 16:50 GMT Shirley (Strutton) Dalton wrote:

Hi!

Now that you have had a little time to try WikiTree, there are a few more features you may find useful.

Ideas on what to include in a profile can be found in Styles and Standards, including some tips on writing biographies.

If you need to describe an event, an heirloom or a location relevant to your research, you may like to learn about Free Space Profiles.

Lastly, sometimes you'll run into unresponsive profile managers. We have a process for resolving those unfortunate situations.

If you have any questions, feel free to ask via my profile page.

Shirley Dalton, WikiTree Mentor

On 17 Nov 2016 at 15:39 GMT Margaret (Good) Espaillat wrote:

Hi Stephen,

You are now a confirmed member of WikiTree. Thank you for volunteering, and I wish you luck in figuring out who your Elmers are.

Have fun and ask for help if you need it. WikiTree members are always eager to offer guidance to a fellow genealogist. 

If you need additional help, our Mentors Project is a friendly bunch of volunteers who will be glad to assist you with WikiTree-specific problems.

Question of the week: What do you do with unidentified photos?


See you in the branches –

Margaret

On 17 Nov 2016 at 15:10 GMT Margaret (Good) Espaillat wrote:

Welcome to Wikitree! I'm so glad you found us!

Wikitree is one BIG world-wide family tree that is freely accessible to everyone. Our goal is to have one profile per person which means we all work together as a BIG friendly and polite collaborative team!

If you are interested in sharing your research and want to collaborate to add your family, please fill out the TAGS on your profile page and click SAVE TAG(s) AND VOLUNTEER.

Your Tags can include names like JOHNSON (a surname) or NEW_ZEALAND (a location) and a comment explaining why this subject interests you.

Once you choose to Volunteer, one of our Greeters will be happy to confirm your membership, and you'll be on your way! Welcome to the Family!

Margaret



Queen Elizabeth II Stephen is 20 degrees from Kevin Bacon, 20 degrees from Joseph Broussard, 24 degrees from Queen Elizabeth II Windsor and 20 degrees from Isabella I de Castilla y León on our single family tree. Login to find your connection.

E  >  Elmer  >  Stephen Elmer