Stephen Alfred Elmer

Stephen Elmer

Privacy Level: Private with Public Biography and Family Tree (Yellow)
Mr. Stephen A. Elmer aka Mallen
Born 1950s.
Ancestors ancestors
Brother of [private sister (1940s - unknown)] [half] and [private sister (1950s - unknown)] [half]
Descendants descendants
Father of [private son (1990s - unknown)]
Account confirmed 17 Nov 2016 | Stephen's 425 contributions | 238 thank-yous received
Elmer-1809 created 17 Nov 2016 | Last modified
This page has been accessed 464 times.
Wiki Genealogist January 2017 Club 100 Puritan Great Migration Project Member United Kingdom Project Member December 2016 Club 100 LDS Project Member DNA Tested Pre-1700 Honor Code Signatory Volunteer
[view badges]

== Biography == *First-hand information. Entered by Stephen Elmer at registration. Descendent of Edward Elmer one of the founders of Hartford, CT. 1600s

Timeline

"""1954"""I was Born and raised in Hollywood, California I know this because I am this person

Name

Stephen Alfred (ELMER) Mallen

Story I was raised in Hollywood California, and I served in the Army and was released 1973 I began working for the Studios in Hollywood, Specialized in Rigging and Lighting. I worked many shows in the Theatre, Broadway plays like Cats, Wiz, Singing in the rain, Phantom of the Opera. Many Television Shows Donny and Marie, Academy Awards, Price is right and so many more. I also started learning Kung Fu, the Hung Kuen system, Kuen meaning family style of the martial arts World and also known as Hung-Gar. An Art descendent from the Shaolin temple in the 1700s. The Art is Famous for the Tiger & Crane style Kung Fu system using the moves from these animal's, also known for the Snake, Dragon and Leopard techniques. The art is also known in the States from my teacher Master Bucksam Kong Founder 1963 of the Siu Lum Pai Gung Fu Assoc. In 1979 Opening a school for my Sifu or teacher in SLC, Utah 1979. I also taught at the University of Utah and spread the Art to the public. Moving back to Hollywood in1984 learning and teaching and working until 1991 and moved back to SLC had children Andrew and Ashlee. Now in Arizona retired.. Here is a FB link!

== https://www.facebook.com/groups/hungkuenkungfu/ Stephen

Sources

<reference />

  • My Allele Results

SampleID Marker+ Chr Start End Allele


7854 A12481 ChrY 21186262 21186262 C- 7854 A2284 ChrY 21186403 21186403 A+ 7854 DYS449 ChrY 8217908 8218262 29 7854 DYS458 ChrY 7867839 7867961 16.2 7854 M8866 ChrY 21186263 21186263 C- 7854 YP1144 ChrY 21186284 21186284 C- 7854 Z11851 ChrY 21186263 21186263 C-

A2284 HG19 Position: ChrY:21186403..21186403 Ancestral: G Derived: A Reference: Michael Thompson (2015) ISOGG Haplogroup: R1b (not listed) Comments: .

Reverse Primer: A2284_R GCAGAAAGTGGAGCCAAAAG


More Genealogy Tools


Only the Trusted List can access the following:
  • Stephen's formal name
  • full middle name (A.)
  • e-mail address
  • exact birthdate
  • birth location
  • images (7)
  • private siblings' names
  • private children's names (1)
  • spouse's name and marriage information
For access to Stephen Elmer's full information you must be on Stephen's Trusted List. Please login. See the Contact section of the Tree & Tools page.


Sponsored by MyHeritage




Followed Tags
Stephen is a Wiki Genealogy Volunteer following these tags:
AYLMER
Family 1600s-1500s-1400s
ELMER
Who are we? Researching Family from the line of Edward Elmer 1600s One of the Founders of Hartford, CT. May have lines to John Elmer-Aylmer Bishop of England 1500s
ELMORE
Other family names
LDS
LDS Family Research and LDS Pioneers in my Family.
NORWAY
Seim Town in Norway looking for info
PGM
Looking for Edward Elmer and info on the ship LYONS.
PURCELL
May have half sister Cindy in Michigan, her mother was Miss Michigan I heard.
SEIM
Mothers side - Country of Norway and a town called Seim I believe.


DNA Tested
Stephen Elmer's DNA has been tested for genealogical purposes. It may be possible to confirm family relationships by comparing test results with Stephen or other carriers of his ancestors' Y-chromosome or mitochondrial DNA. Y-chromosome DNA test-takers in his direct paternal line on WikiTree:

Have you taken a DNA test for genealogy? If so, login to add it. If not, see our friends at Family Tree DNA.



Collaboration
  • Login to request to the join the Trusted List so that you can edit.
  • Private Messages: Send a private message to Stephen. (Best for comments to Stephen that need to be private.)
  • Public Comments: Login to post. (Best for messages to or about Stephen that can be public. Limit 20 per day.)

On 10 Jan 2017 at 21:41 GMT Vic Watt wrote:

Stephen,

U have awarded you PGM Project Member badge. Please be sure to read the Project page. Sorry for the delay, but I have been sick for a while and was doing minimal WikiTree work. Vic

On 9 Jan 2017 at 06:53 GMT Roxanne Baker wrote:

Hello Stephen - I do not know of Seim specifically. Have you done any research for your Norwegian family? Do you know where they are from in Norway?

Roxanne C Basey

On 2 Jan 2017 at 22:07 GMT Robin Lee wrote:

As a reminder, our Honor Code and Pre-1700 Certification are clear about the need for sources. If you need help understanding how to add sources, please take a look at https://www.wikitree.com/wiki/Sources

On 1 Jan 2017 at 09:24 GMT Maria Maxwell wrote:

Hi Stephen and thanks for your message.

I've added the United Kingdom Project badge to your profile. If you click on the badge it will take you to the full list of our wonderful members. Click on United Kingdom Project will take you the first page of the project. Scroll down to Member Interests. I've added your good self.

Thanks again for joining enjoy and good luck with your research Maria

On 24 Dec 2016 at 17:47 GMT Stephen Elmer wrote:

I have new DNA test to add here but I am lost. Help Please.....

On 1 Dec 2016 at 16:50 GMT Shirley (Strutton) Dalton wrote:

Hi!

Now that you have had a little time to try WikiTree, there are a few more features you may find useful.

Ideas on what to include in a profile can be found in Styles and Standards, including some tips on writing biographies.

If you need to describe an event, an heirloom or a location relevant to your research, you may like to learn about Free Space Profiles.

Lastly, sometimes you'll run into unresponsive profile managers. We have a process for resolving those unfortunate situations.

If you have any questions, feel free to ask via my profile page.

Shirley Dalton, WikiTree Mentor

On 17 Nov 2016 at 15:39 GMT Margaret (Good) Espaillat wrote:

Hi Stephen,

You are now a confirmed member of WikiTree. Thank you for volunteering, and I wish you luck in figuring out who your Elmers are.

Have fun and ask for help if you need it. WikiTree members are always eager to offer guidance to a fellow genealogist. 

If you need additional help, our Mentors Project is a friendly bunch of volunteers who will be glad to assist you with WikiTree-specific problems.

Question of the week: What do you do with unidentified photos?


See you in the branches –

Margaret

On 17 Nov 2016 at 15:10 GMT Margaret (Good) Espaillat wrote:

Welcome to Wikitree! I'm so glad you found us!

Wikitree is one BIG world-wide family tree that is freely accessible to everyone. Our goal is to have one profile per person which means we all work together as a BIG friendly and polite collaborative team!

If you are interested in sharing your research and want to collaborate to add your family, please fill out the TAGS on your profile page and click SAVE TAG(s) AND VOLUNTEER.

Your Tags can include names like JOHNSON (a surname) or NEW_ZEALAND (a location) and a comment explaining why this subject interests you.

Once you choose to Volunteer, one of our Greeters will be happy to confirm your membership, and you'll be on your way! Welcome to the Family!

Margaret



Queen Elizabeth II Stephen is 20 degrees from Kevin Bacon, 25 degrees from Campbell Braddock, 24 degrees from George Herbert and 25 degrees from Queen Elizabeth II Windsor on our single family tree. Login to find your connection.

E  >  Elmer  >  Stephen Elmer